Figure 1From: Generation of microsatellite repeat families by RTE retrotransposons in lepidopteran genomesHeliconius melpomene HmRTE-e01 non-LTR retrotransposable element identified from a BAC clone (GenBank:CU462842). Characteristics of the full-length HmRTE-e01 element identified from the Heliconius melpomene BAC clone AEHM-22C5 (GenBank:CU462842). The element is inserted in the minus strand of the BAC clone from nucleotide position 30,546 to 27,284. It has a single open reading frame that encodes a 990 amino acid protein sequence. AP marks the Exonuclease/Endonuclease/Phosphatase domain and RT indicates the RT_nLTR_like domain. The element has a 276 bp 5' untranslated region (UTR) and a 14 bp short 3' UTR that includes the (GAA)2GA simple repeat units represented by diagonal stripes. The stop codon (TAA) located at 27,300 - 27,298 and is indicated by '*'. Immediately flanking the HmRTE-e01 element are two 20 bp target-site duplication (TSD, represented by filled dark boxes) sequences of 'AGATATACTTCGTTTAAACT'.Back to article page