Skip to main content

Table 2 Primers and reaction conditions for mitochondrial DNA fragment amplification

From: Distant hybrids of Heliocidaris crassispina (♀) and Strongylocentrotus intermedius (♂): identification and mtDNA heteroplasmy analysis

No. Primer Sequence (5′-3′) HC_F SI_C Annealing temperature Extension time
Position (bp) Identity (%) Position (bp) Identity (%)
I HSM1F TAACGGATTAAAGCACAGCACTGAA 9879-9903 96.00 9877-9901 100.00 61 °C 3 min 30 s
HSM1R CGCATAGAGCTTGAAGGGAATTTAA 13,094-13,118 96.00 13,089-13,113 100.00
II HSM2F TCTTGTTTTCTTGTTTTTGTGAGTT 2812-2836 68.00 12,874-12,898 100.00 54 °C 3 min
HSM2R CTCGTGTATCAACATCCATTCC 3541-3562 63.64 886–907 95.45
III HSM3F TGCCATGATTGCAATAGGAGT 825–845 85.71 825–845 100.00 57 °C 3 min 30 s
HSM3R ATCTACAAAGTGTCAGTATCAGGCA 4251-4275 92.00 4250-4274 100.00
IV HSM4F CCACTTCTCAACCCATCACCACTTT 4212-4236 92.00 4211-4235 96.00 53 °C 3 min 30 s
HSM4R CTATTCCTTGGGGGCCTATTTCTTC 8060-8084 80.00 8058-8082 100.00
V HSM5F TTTTATCTCCTCCCTTTTTATYTCT 8008-8032 76.00 8006-8030 96.00 55 °C 2 min
HSM5R CCTCWAAAGTAGTTAAGATTGGGAC 9955-9979 76.00 9953-9977 96.00
VI HcM1F ATCCTGCCTTCCGTTATTTTA 9879-9903 96.00 9877–9901 100.00 53 °C 2 min
HcM1R CAACAGTGGTTTGGTCCTTCT 13,094-13,118 96.00 13,089-13,113 100.00
VII RandomF CCGCAAGGGAAAGATGAAATAC 14,289-14,310 100.00 14,285-14,306 100.00 52 °C 4 min
RandomR GGGGTGTTATTCTTCTAAGTATTGA 2600-2624 84.00 2598-2622 100.00
VIII HcM2F GAAGGACAAGAACTGGAGAC 2096-2116 100.00 1698-1717 75.00 53 °C 3 min
HcM2R CTTTGCGAGATAGATTTAGC 4851–4870 100.00 10,672-10,691 33.33
IX HcM3F ACTTTTGTTTTTCAATAAATCCCTCCA 7680-7706 100.00 8631-8657 70.37 55 °C 2 min 30 s
HcM3R TTTCTTTCTAACCACCCTTTTCACC 10,229-10,253 100.00 10,230-10,254 88.00
X RDF TATCATTTAGTAGACCAAAGCCCAT 3559-3583 100.00 3557-3582 100.00 52 °C 40 s
RDR CCTGTAGCGACAAAGAAGGTAGAAC 4118-4142 80.00 4117-4141 100.00